X

Код презентации скопируйте его

Ширина px

Вы можете изменить размер презентации, указав свою ширину плеера!

Что такое биоинформатика

Скачать эту презентацию

Презентация на тему Что такое биоинформатика

Скачать эту презентацию
Cлайд 1
Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ... Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ
Cлайд 2
Что такое биоинформатика? Исследование информационных процессов в биологическ... Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п. ?
Cлайд 3
Биоинформатика Исследование информационных процессов в биологических системах... Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.
Cлайд 4
Примеры задач биоинформатики Разработка алгоритмов для анализа большого объем... Примеры задач биоинформатики Разработка алгоритмов для анализа большого объема биологических данных Алгоритм поиска генов в геноме Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами. Изучение структуры активного центра белка Разработка программного обеспечения для управления и быстрого доступа к биологическим данным Создание банка данных аминокислотных последовательностей
Cлайд 5
Что понимать под биоинформатикой? Как видим, смысл термина ещё ỳже... Примене... Что понимать под биоинформатикой? Как видим, смысл термина ещё ỳже... Применение компьютерных методов для решения биологических задач Применение компьютерных методов для решения задач молекулярной биологии ... и еще ỳже... Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации
Cлайд 6
Итак... Биоинформатика = вычислительная молекулярная биология Почему так сузи... Итак... Биоинформатика = вычислительная молекулярная биология Почему так сузился смысл термина?
Cлайд 7
gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagtt... gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa
Cлайд 8
В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспе... В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК Организм ДНК «в пробирке» Последовательность выделение секвенирование ...TGCCACAAATCAC...
Cлайд 9
Для хранения все возрастающей информации о последовательностях ДНК в 1982 год... Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях 2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов) Размер файлов — 196 Gb
Cлайд 10
Пионеры биоинформатики Лайнус Полинг 1962 Zuckerkandl, E., and L. Pauling. 19... Пионеры биоинформатики Лайнус Полинг 1962 Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166. Анализ аминокислотных последовательностей глобинов нескольких позвоночных Гипотеза молекулярных часов
Cлайд 11
Пионеры биоинформатики Маргарет Дейхофф Однобуквенный код аминокислот A,C,D,E... Пионеры биоинформатики Маргарет Дейхофф Однобуквенный код аминокислот A,C,D,E,F,G,H… Матрицы аминокислотных замен PAM (Point Accepted Mutation) 1965 Атлас последовательностей белков и их структур (1965)
Cлайд 12
Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1... Первый “банк данных” Атлас белковых последовательностей и их структур 1965 -1978 Первая версия атласа содержала описание 65 (!) последовательностей белков
Cлайд 13
Банки данных Архивные (примеры: PDB, GenBank) за содержание каждой записи отв... Банки данных Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор Курируемые за содержание записей отвечают специальные люди — кураторы Автоматические записи генерируются компьютерными программами
Cлайд 14
Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последователь... Банк данных Swiss-Prot 1986 Swiss-Prot – база знаний о белковых последовательностях http://www.expasy.org/sprot/ Курируемая база данных “Золотой стандарт” аннотации
Cлайд 15
Банк данных Swiss-Prot Амос Байрох Руководитель группы Swiss-Prot в Швейцарск... Банк данных Swiss-Prot Амос Байрох Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики С 1987 поддерживается в сотрудничестве между Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EBI)
Cлайд 16
Банк данных Swiss-Prot Статистика роста количества документов Текущий релиз 4... Банк данных Swiss-Prot Статистика роста количества документов Текущий релиз 48.9 (24 января 2006) содержит 206586 документов 1986 2006 2001
Cлайд 17
Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последо... Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация TrEMBL (Translated EMBL) Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа
Cлайд 18
Тенденция объединения 2002 Тенденция объединения 2002
Cлайд 19
Банк данных UniProt UniProt (Universal Protein Resource) UniProt Knowlegebase... Банк данных UniProt UniProt (Universal Protein Resource) UniProt Knowlegebase – SwissProt+TrEMBL UniProt Archive – UniParc UniProt Reference – UniRef
Cлайд 20
~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьюте... ~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьютерная аннотация UniRef (UniProt non-redundant Reference databases) UniParc (UniProt Archive) 200 000 последовательностей Экспертиза Базы данных научной литературы
Cлайд 21
Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206... Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 586 Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!
Cлайд 22
Документ банка данных Swiss-Prot Описание документа: идентификатор, имя, дата... Документ банка данных Swiss-Prot Описание документа: идентификатор, имя, дата создания и модификации Аннотация последовательности Последовательность
Cлайд 23
Основные поля записи SwissProt ID AC DE OS OC И сама последовательность, коне... Основные поля записи SwissProt ID AC DE OS OC И сама последовательность, конечно.
Скачать эту презентацию
Наверх